GBB166.1E Siemens Привод воздушной заслонки без пружинного возврата--> &--> Мясорубка Severin FW 3781

Мясорубка Severin FW 3781


Reviewed by:
Rating:
5
On 02.01.2019

Summary:

.

Мясорубка Severin FW 3781

мощность 600 Вт;насадка для приготовления колбас, насадка для нарезки печенья, диск для фарша;корпус из пластика


Обзор:

Мясорубка Severin FW 3781

View and Download SEVERIN AKKU-HAARSCHNEIDEMASCHINE HS 7810 dimensions online. AKKU-HAARSCHNEIDEMASCHINE HS 7810 Appliances pdf manual download. Also for: At 2578 automatik-toaster dekor, Automatik-langschlitz-toaster at 2587.

rot, Automatik-langschlitztoaster at.

Мясорубка Severin FW 3781


Jan 11, 2014 · Get YouTube without the ads. Skip 1 month free.

Мясорубка Severin FW 3781

Find out why Close. Мясорубка ProfiCook PC FW 1004 Диль Игорь.
Handleidingen van Severin kunt u hier en downloaden.

Severin Other User Manuals Download - ManualsLib

Selecteer uw product en ontvang de handleiding.
Questi sono gli altri: - disegni tecnici Severin - manuali per l’uso BM 3986 - schede prodotto Severin - opuscoli - o etichette energetiche Severin BM 3986 Tutti sonoma le più importanti dal punto di vista di utilizzo del dispositivo possono essere trovate nel manuale per l’uso Severin BM 3986.

Мясорубка Severin FW 3781


Page If the appliance is по ссылке used a bathroom, it must be positioned outside General information the 3m area (see diagram) in such a way A massage helps to reduce tension in that the rotary switch cannot be reached muscle and tissue areas, enhancing blood by anyone using the shower or bath.

/> Ask the question you have about the Severin BM 3986 here simply to other product owners.

Мясорубка Severin FW 3781

Provide a clear and comprehensive description of the problem and your question. The better your problem and question is described, the easier it is other Severin 3986 owners to provide you with a good answer.

Мясорубка Severin FW 3781


Today, SEVERIN employs about 1.200 workers. The company, headquartered in the Sauerland region in Germany, has a product that includes more than 200 different electronic devices. The selection includes items such as coffeemakers, jug kettles, toasters, egg boilers, barbecue and raclette grills and mixers as well as.

Мясорубка Severin FW 3781


Como veíamos antes, el Severin MW 9675 es un microondas que cocina por convección, descongela, y tiene grill por lo cual de por si es muy completo, pero debemos añadir que tiene una capacidad de 23 litros, y una potencia de microondas de 800 w, una potencia de 1200w de grill y de 1200 de convencción, lo cual lo hace un microondas Клей WAKOL PU 215, y apto para de los de cocciones.


Como comentábamos antes, el microondas Severin es un microndas que cocina por Convección, descongela, y tiene grill por cual de por si es muy completo, pero debemos añadir que tiene una capacidad de 25 litros, y una potencia de microondas de 900 w, una potencia 1400w de grill y de 2400 w de convencción, lo cual lo hace un microondas verdaderamente potente, https://xn--c1akdctmh4h.xn--p1ai/amp/testo-905-t2-termometr-stik-klassa-poverhnostniy-gosreestr.html en el cual te podemos.

Мясорубка Severin FW 3781


Manuals for to download for viewing them online or printout as PDF. Manuals Online.

SEVERIN AKKU-HAARSCHNEIDEMASCHINE HS 7810 DIMENSIONS Pdf Download.

Which manuals are you looking for? PDFs only. Pazour, Program in Molecular Medicine, University of Medical School, Biotech II, Suite 213, 373 Plantation Street, Worcester, MA 01605.
Email: Intraflagellar transport IFT complexes A and B build and maintain primary cilia.
In the mouse, kidney-specific or hypomorphic mutant alleles of IFT complex B genes cause polycystic kidneys, but the influence of IFT complex A proteins on renal development is not well understood.
In the present study, we found that HoxB7-Cre—driven deletion of the complex A gene Ift140 from collecting ducts disrupted, but did not completely prevent, cilia assembly.
Mutant kidneys developed collecting duct cysts by postnatal day 5, with rapid cystic expansion and renal dysfunction by day 15 and little remaining parenchymal tissue by day 20.
In contrast to many models Радиатор стальной ERK 20 (66х600х800 мм) подключение Elsen ERK200608 polycystic kidney disease, precystic Ift140-deleted collecting ducts showed normal centrosomal positioning and no misorientation of the mitotic spindle axis, suggesting that disruption of oriented cell division is not a prerequisite to cyst formation in these kidneys.
Precystic collecting ducts had an increased mitotic index, suggesting that cell proliferation may drive cyst expansion even with normal orientation of the mitotic spindle.
In addition, we observed significant increases in expression of canonical Wnt pathway genes and mediators of Hedgehog and tissue fibrosis in highly cystic, but not precystic, kidneys.
Taken together, these studies indicate that loss of Ift140 causes pronounced renal cystic disease and suggest that abnormalities in several different pathways may influence cyst progression.
Genesis of primary cilia—specialized microtubular-based sensory structures that project from most cells—requires intraflagellar transport IFTa bidirectional process that builds, maintains, and disassembles these organelles.
IFT also supports diverse signaling roles played by primary cilia that influence development, differentiation, and cell cycle regulation.
Mutations that produce structural or functional defects жмите сюда renal cell primary cilia cause abnormal proliferation of tubular epithelia, increased fluid secretion, and polycystic kidney disease.
The IFT system consists of two large protein complexes, IFT complexes A and B, that are transported by kinesin-2 and cytoplasmic dynein-2.
Hypomorphic mutations in Ift88 or kidney-specific deletion of Ift20, two IFT complex B genes, cause renal cyst formation.
In contrast, very little is known about what, if any, role is played by IFT complex A proteins on mammalian renal development and renal physiology.
In invertebrate organisms, mutation or RNA interference depletion of individual IFT complex A proteins produces cilia that are shortened and often dilated and accumulate ciliary proteins.
In mice, null alleles of individual IFT complex A proteins, including IFT139, IFT122,and IFT121, produced defects in skeletal, craniofacial, and nervous systems that caused embryonic or neonatal death.
Because of the early lethality of IFT complex A mutants, there is no information as to whether IFT complex A defects would disrupt renal development or function in mice.
In Ift122 zebrafish morphants, pronephric cysts were observed ; in contrast, Ift140 morphants showed no apparent ciliary or sensory neuron defects.
Some cranioectodermal dysplasia patients exhibit renal disease characterized by extensive glomerular sclerosis, renal cysts, interstitial fibrosis with focal inflammatory cell infiltration, scattered tubular atrophy, and chronic renal failure.
Results To understand the role of IFT140 in cystic kidney disease, we used Knockout Mouse Project KOMP embryonic stem ES cellsto create flox and null1 alleles.
Animals homozygous for Ift140 flox are viable with no detectable phenotypes, whereas animals homozygous for Ift140 null1 die at midgestation and will be described in a separate publication.
In this work, we used HoxB7-Cre to delete Ift140 in the collecting ducts.
During interphase, IFT140 localizes prominently to the ciliary base and tip and узнать больше здесь is found along the ciliary shaft.
Other IFT proteins including IFT20 localize to the spindle pole during mitosis.
In control postnatal p 5 kidneys, IFT140 labels the base of the cilium just adjacent to the centrosome.
Staining of experimental kidneys indicates that, at most, very short cilia remain at p5 and no IFT140 staining is observed.
These results indicate that the conversion of the Ift140 flox allele to the Ift140 null2 allele is efficient and that IFT140 is required for ciliary assembly.
HoxB7-Cre efficiently deletes the Ift140 flox allele.
A Diagram of targeting vector.
Exons are displayed as boxes, whereas the coding region is shaded in black.
B Affinity-purified anti-MmIFT140 detects a single band in protein extracts from the mouse cell lines 488 and IMCD3 but nothing in the human cell line hTert-RPE.
The MEK Western was also probed with a tubulin antibody B-5-1-2 as a loading control.
C In interphase control primary kidney cells, IFT140 red is found most strongly at the base arrow of the cilium green, 6-11B-1 and is also found along the ciliary shaft and at the tip.
These cells were also labeled with Dolichos biflorus agglutinin DBA in green to mark collecting duct cells.
Note that DBA staining is far weaker than the 6-11B-1 staining.
Asterisk marks an unidentified structure labeled by the IFT140 antibody in both experimental and control cells.
Scale bar, 5 μm for both images.
Bottom panels are three-time enlargements of the ciliary region shown as merged images and green 6-11B-1 and red IFT140 channels separately.
D In mitotic IMCD3 cells, IFT140 green is found in puncta in the cytoplasm but is not associated with the spindle pole bodies arrows.
Arrowheads mark cilia stained by IFT140 in neighboring cells.
In contrast, IFT20 green is found at the spindle pole bodies arrows and in the cytoplasm.
The arrowhead marks IFT20 staining the Golgi complex in a neighboring cell.
In both images, red is anti—α-tubulin.
Scale bar, 5 μm for both images.
Note that DBA staining is weaker than the 6-11B-1 staining and does project in these images but was visible to identify collecting ducts.
Arrows mark centrosomes in collecting ducts.
Size bar, 10 μm for all images.
Images are maximum projections of 13 confocal Z-images taken 0.
F Kidneys from control and experimental p5 animals were stained for centrosomes green, γ-tubulincollecting ducts green, DBAIFT140 redand nuclei blue, DAPI.
Note that the DBA staining is weaker than the γ-tubulin staining and does project in these images, but it was visible to identify collecting ducts.
Arrows mark centrosomes in collecting ducts.
Insets are three-time enlargements of at arrows.
Size bar, 10 μm for all images.
Images are maximum projections of 13 confocal taken 0.
HoxB7-Cre expression begins with mesonephric duct development 6—9 days before birth before formation of the ureteric bud, the progenitor of adult collecting ducts.
Collecting duct deletion of Ift140 led to pronounced postnatal renal cyst formation.
At p0, there are modest medullary collecting duct dilations but no renal cysts.
By p5, extensive medullary cysts are evident, with minimal cortical cysts.
By p10, cysts are present in medullary and cortical regions, and by p20, extensive cysts are found throughout the kidney, with little remaining parenchymal tissue.
Kidney weights increased progressivelyand blood urea nitrogen levels were elevated in mutants at p15 and p20consistent with renal failure during the third week of life.
Deletion of Ift140 in mouse collecting ducts causes renal cysts and renal failure.
A Gross morphology of experimental kidneys top pair and control kidneys at p20.
Experimental kidneys at p0 are normal except for some minor dilation of the medullary collecting ducts arrows but become cystic arrows with age.
Scale bars, 200 μm for both images in a pair.
C Mean ± SEM individual kidney weights of control open bars and experimental filled bars animals at 5-day intervals between p0 and p20.
D BUN levels mean ± SEM in control and experimental animals at p15 and p20.
Control collecting ducts were highly ciliated at birth, whereas experimental p0 collecting ducts had no or very short cilia.
There was no ciliary loss in noncollecting duct cellssupporting the specificity of HoxB7-Cre for the collecting duct system.
Although there may be a progressive loss of these shortened cilia over time, many collecting duct cells still carried stumpy cilia at p10 and p20.
These shortened cilia show increased staining with IFT88 compared with controls.
Similarly, Ift140-deleted cultured cells showed increased ciliary staining with IFT88 and IFT27 antibodies.
Effects of Ift140 deletion on cilia.
A Kidneys from control and experimental animals were stained for cilia red, 6-11B-1collecting ducts green, DBAand nuclei blue, DAPI at the day of birth p0and postnatal days 5, 10, and 20.
Arrows mark collecting ducts, and arrowheads mark ciliated nephrons near collecting ducts; cysts and dilated ducts are marked with a C.
Size bar, 10 μm.
Insets are four-time enlargements of areas marked by the arrow.
Images are maximum projections of 16 confocal Z-images taken 0.
B IFT88 accumulates in mutant cilia.
Kidneys from p5 control and experimental animals were stained for IFT88 redacetylated tubulin green, ciliaDBA green, collecting ductsand nuclei blue, DAPI.
Size bar, 5 μm for all images in C.
Images are maximum projections of 26 confocal Z-images taken 0.
Note that Ift140 experimental cells IFT88 and IFT27 in the cilia.
Size bar, 10 μm for all images.
During normal tubular development, the mitotic spindle of dividing cells orients in parallel to the longitudinal axis of the nephron.
In many different polycystic kidney disease PKD models, randomization of the mitotic spindle axis may be a critical part of the cystogenic program.
At p5, many experimental collecting ducts were already dilated; these ducts were excluded from analysis to focus on events occurring before the duct lost its normal architecture.
In control collecting ducts, mitotic spindles aligned with the long axis of the tubule.
In contrast to what we observed in Ift20-deleted kidneys, loss of Ift140 did not alter mitotic spindle orientation in precystic collecting ducts.
Whereas deletion of Ift20 from the collecting ducts caused mislocalization of the centrosome from the center of the apical end of the cell, deletion of Ift140 did not produce this phenotype, because the centrosomes remained apically positioned even in the highly cystic p20 ducts.
Deletion of Ift140 does not lead to mitotic spindle misorientation or centrosomal abnormalities in collecting duct cells.
A In normal p5 kidney tubules, mitotic spindles red, phospho-histone H3 typically orient parallel to the long axis of the collecting duct green, DBA; A, left and B, open bars.
The absence of IFT140 does not alter this relationship in p5 collecting ducts A, right and B, filled bars.
Size bar, 10 μm for all four images.
Images are maximum projections of 15 confocal Z-images taken 0.
B Mitotic spindle orientation quantitation.
Mitotic collecting duct больше на странице were photographed, and the angle between the long axis of the tubule and the spindle was measured as depicted in the schematic diagram in left; angles were grouped into 10° bins.
In normal kidneys, centrosomes red, GTU-88 are normally found at the center of apical surface of the cell.
This location is not altered when Ift140 is deleted.
Scale bar, 5 μm for all images in C.
Images are maximum projections of three confocal Z-images taken 0.
Increased cell proliferation is a hallmark of cystic kidney diseases.
Mouse kidneys undergo substantial postnatal development, and consequently, both experimental and control kidneys have relatively high levels of mitotic cells at p5; however, the percentage of mitotic cells is significantly higher when Ift140 is deleted.
Postnatal development normally completes within the first 3 weeks of life and the rate of proliferation declines, but in Ift140-deleted collecting ducts, proliferation remains high.
Apoptosis is normally very low in healthy kidneys but is elevated in cystic kidneys.
Similar to published reports, we found very low numbers of cleaved caspase-3—positive cells in адрес collecting ducts of control animals at either p5 or p20, and this finding was not significantly altered when Ift140 was deleted.
At p20, apoptosis was observed in noncollecting duct cells, probably a result of the expanding cysts impinging on their neighbors.
Proliferation and apoptosis in Ift140-defective collecting ducts.
A p5 kidneys labeled with phospho-histone H3 red and DBA green to identify mitotic collecting duct cells arrows.
Size bar, 10 μm.
B p5 and p20 kidneys labeled with cleaved caspase-3 red and DBA green to identify apoptotic collecting duct cells arrow.
At p20, most apoptotic cells arrows were outside of the cysts />Images are maximum projections of three wide-field images taken 2 μm apart.
Size bar, 10 μm for all images in B.
Apoptotic cleaved caspase-3—positive cells were counted in 1000 cells from cortical collecting ducts or cortical cysts in p5 and p20 Ift140 control open bars and experimental filled bars kidneys.
Abnormalities in diverse signaling pathways have been implicated in renal cyst initiation or expansion.
For example, canonical Wnt is up-regulated in many cystic kidney models and human autosomal dominant PKD.
Deletion of Ift140 increases activated dephospho-β-catenin levels in both nucleus and cytoplasm.
To understand the relationship between cyst development and Wnt signaling, we performed a time course analysis, examining expression of genes associated with canonical Wnt signaling.
We also measured Ift140 mRNA, was significantly reduced but not absent at all time points.
This finding was expected, because mRNA was isolated from whole kidney; however, Ift140 was deleted only in collecting ducts.
Expression of Axin2 and Lef1 declined over postnatal development in both groups, with rate of decline greater in controls; therefore, both genes were significantly higher in p20 mutants.
Postnatal β-catenin Ctnnb1 expression gradually declined in control but not in mutant kidneys, resulting in significantly elevated Ctnnb1 mRNA in mutant kidneys at p15 and p20.
Wnt10a expression is low in control and experimental kidneys at p0, increases in both groups up until p10, and then declines in controls over the next 10 days while continuing to increase in mutant kidneys.
Altered canonical Wnt signaling and selected gene expression in collecting duct Ift140-deleted kidneys.
A Western blot analysis of β-catenin.
Control Con and experimental Exp kidneys were fractionated into cytosol and nuclear fractions and analyzed by Western blots with antibodies to β-catenin and dephosphorylated active β-catenin.
RelB and glyceraldehyde-3-phosphate dehydrogenase GAPDH are loading controls.
Each lane is a different animal.
B Quantitative PCR analysis of 12 genes in experimental filled bars and control open bars kidneys at selected postnatal times.
Bars depict mean ± SEM of 5—11 individual mouse kidneys in each treatment and age group.
Gene expression data are normalized to GAPDH expression.
Raw data and statistical analysis of temporal changes of gene expression are included in.
To understand how deletion of Ift140 affects other signaling processes, selected genes from additional candidate pathways can DPA FIO66F00-2-IE1-B completely in kidney development and cystic disease were examined.
Although Hedgehog signaling has not been implicated in cystic disease, it plays essential roles in kidney development and is highly interconnected with cilia.
Hippo signaling has recently been implicated in cystic disease, and expression of the Hippo-regulated gene Birc3 is elevated late in cystic disease development in Ift140-deleted kidneys.
The fibrosis-associated genes Ctgf and InhbA are downstream targets of Hippo signaling, and their expression in Ift140-deleted kidneys is similarly elevated late in disease.
Consistent with increased expression of fibrosis genes, Ift140-deleted cystic kidneys were fibrotic, showing increased interstitial cell smooth muscle actin staining and increased collagen deposition.
Activation of innate immunity has been described in cystic kidneys.
Fibrosis accompanies the development of cystic disease.
A Interstitial cells in experimental p20 animals show increased staining with smooth muscle actin arrow compared with controls.
Arrowheads depict vascular structures in both genotypes.
Scale bar, 50 μm.
B Trichrome blue staining reveals increased collagen deposition arrow in experimental kidneys at p20.
Scale bar, 100 μm.
Discussion It has now well appreciated that ciliary defects lead to cystic disease and that IFT is critical for building cilia and maintaining the proper signaling environment within these organelles.
However, the role of IFT complex A proteins in cystic disease was not previously known, because all of the mouse IFT mutants with cystic phenotypes were in IFT complex B proteins or molecular motors.
These observations suggested that complex B is more important for anterograde transport of materials from the cell body to the cilium tip, whereas complex A is more important for retrograde transport of materials from ciliary tip to cell body.
This binary model overlooks the complexity of the IFT system.
Complex A and B proteins are trafficked in both directions, likely as part of a large train, and retrograde transport requires prior anterograde transport to deliver IFT particles to the tip of the cilium before retrograde transport can actually occur.
Moreover, two recent studies implicate complex A proteins in anterograde trafficking of materials into cilia.
Mutations in Drosophila Ift140 produced shortened chordotonal cilia with reduced amounts of a TRPV calcium channel.
Similarly, RNA interference-induced depletion of IFT-A proteins, including IFT140, blocked G protein—coupled receptor trafficking into mammalian primary cilia.
Taken together, продолжить чтение findings suggest that IFT140 and other complex A proteins play additional roles in ciliary function in addition to mediating retrograde IFT.
Our finding that the loss of IFT140 did not affect mitotic spindle orientation was unexpected, because the presence of aberrant mitotic spindle orientation in a number of cystic models suggested that it may be a driving force for the expansion of tubules into cysts.
However, the presence of normally oriented mitotic spindles in Ift140-deleted collecting ducts indicates that randomization of spindle orientation is not a prerequisite for cystic disease.
This детальнее на этой странице is similar to the work of Nishio et al.
The difference in the ability of Ift20 подробнее на этой странице Ift140 mutant cells to orient their spindles may relate to our observation that, unlike IFT20 and other complex B proteins, IFT140 does not localize to the mitotic spindle pole.
Recent work indicated that IFT88 localizes to the spindle pole and is important in the formation of astral microtubules needed to orient the mitotic spindle within cells.
If astral microtubule formation is a general function of IFT complex B proteins, it may explain why Ift20-deleted absolutely Посудомоечная машина Zigmund & Shtain DW60.4508X opinion have misoriented spindles.
The absence of IFT140 at the spindle pole suggests that this function is not likely a function for this particular protein and possibly all of complex A.
Another difference between IFT20 and IFT140 that may contribute to the difference in oriented cell division is the observation that Ift140 mutant cells still assemble a short ciliary remnant, whereas no ciliary remnants are seen on Ift20 mutant cells.
In Ift20 mutant cells, centrosome position varied widely, localizing anywhere on the apical surface of cells early in cyst development and anywhere in the consider, THT-15-423-2.5 этикетки {brd30127} opinion in advanced cysts.
In contrast, centrosome position was maintained at the center of the apical end of Ift140 mutant cells even in advanced cystic disease.
It is possible that the short cilium assembled on the Ift140 mutant cells is sufficient to properly position the centrosome.
If the interphase centrosome position determines the division plane, then a short cilium may be sufficient to maintain proper orientation of cell division.
How then do kidney cysts form in the face of normally oriented mitoses?
Increased epithelial proliferation and apoptosis have been proposed to contribute to cystic expansion.
Enhanced apoptosis is a characteristic in many PKD models ; however, its role in cyst expansion has not been resolved.
For example, apoptosis has been posited to promote cyst cavitation, trigger proliferation, or serve as a line of defense against neoplastic transformation of damaged cells.
However, increased apoptosis after the loss of Pax2 reduced cystogenesis in pck mice.
There was no significant increase in apoptosis in Ift140-deleted collecting ducts either early or late in the disease, suggesting that apoptosis itself is not driving cytogenesis.
However, it Обои Jannelli & Kerala 5612-JV possible that enhanced proliferation in the absence of enhanced apoptosis is responsible for the rapid cystic expansion observed in Ift140-deleted collecting ducts.
A large unanswered question in ciliary biology and cystic disease research is what is the function of the primary cilium in maintaining tubule architecture and preventing cyst formation?
It is generally agreed that primary cilia are sensory organelles that integrate extracellular signals and regulate signal transduction to control cell physiology.
To understand the pathways influenced by the cilium, we interrogated a number of signal transduction pathways that had been previously identified as being altered in cystic disease.
Hedgehog signaling is critical in kidney development, and in vertebrates, it is organized around the primary cilium.
Hippo signaling regulates organ size and has recently been proposed узнать больше be altered in cystic disease.
It is likely that elevation of proproliferative genes occurs within the rapidly dividing collecting duct epithelium, whereas fibrosis and innate immunity genes may be upregulated in noncollecting cells in response to cyst formation.
The observation that most genes are upregulated after initiation of cyst formation suggests a model in which ciliary dysfunction does not initiate the pathways leading to cystic disease but rather, serves to restrain these pathways to prevent disorganized cell division.
This idea is consistent with the observation that deletion of ciliary genes after postnatal development is completed does not result in cystic disease unless kidney damage occurs.
Embryonic ages were determined by timed mating, with the day of the plug designated embryonic day 0.
The original allele derived from the KOMP cells was designated the Ift140 neo allele.
HoxB7-Cre was used to delete exon 7 in kidney collecting ducts, creating Ift140 null2 in these specific cells.
All mouse work was carried out at the University of Massachusetts Medical School and was approved by the University of Massachusetts Medical School Institutional Animal Care and Use Committee.
Genotyping was carried out with the following primers: 140komp2 TCAGCCCTCTATGCCACTCT, 140komp3 CTTCCCTATGCCTTCAGCAG, and 140komp6 TGGTTTGTCCAAACTCATCAA.
Serum Chemistry Blood urea nitrogen was analyzed by a Roche Cobra Integra 400 Plus at the Comparative Pathology Laboratory, Baylor College of Medicine Houston, TX.
Cell Culture IMCD3 ATCC and 488 cells were grown in DMEM 4.
Primary kidney cells were generated by dispersing kidneys in 0.
Stable lines were selected in the same medium supplemented with 150 mM NaCl and 150 mM urea.
Primary mouse embryonic fibroblasts were generated by dispersing embryos in 0.
Immunofluorescence Microscopy Cells for immunofluorescence microscopy were grown, fixed, and stained as described previously.
Mouse tissues were fixed overnight at 4°C with 4% paraformaldehyde EM Sciences, Hatfield PA in PBS, embedded in paraffin, and processed as described in ref.
Primary antibodies used included antitubulins 6-11B-1, GTU-88, B-5-1-2; Sigma, St.
Louis, MOantiphospho-histone H3 Ser10 Upstate, Lake Placid, NYanti—β-catenin Cell Signaling, Danvers, MAantiactive β-catenin clone 8E7; Upstateanti—glyceraldehyde-3-phosphate dehydrogenase clone 14C10; Cell Signalinganti-RelB N-17; Santa Cruz Biotechnology, Santa Cruz, CAantismooth muscle actin clone 1A4; Sigma-Aldrichand anticleaved caspase-3 Millipore, Billerica, MA.
Anti-MmIFT140 was made by expressing the last 356 of the mouse protein in bacteria as a maltose binding protein fusion and injecting into rabbits.
Antibodies were affinity-purified against the same fragment expressed as a glutathione S-transferase fusion.
FITC-conjugated Dolichos biflorus agglutinin Sigma was added with the secondary antibodies.
AlexaFluor-labeled secondary antibodies Invitrogen Molecular Probes, Carlsbad, CA were used to detect the primary antibodies.
Wide-field images were acquired by an Orca ER camera Hamamatsu, Bridgewater, NJ on a Zeiss Axiovert 200M microscope equipped with a Zeiss 100× plan—Apochromat 1.
Images were captured by Openlab Improvision, Waltham, MA and adjusted for contrast in Adobe Photoshop.
For comparisons made between images, the photos were taken with identical conditions and manipulated equally.
Confocal images were acquired by a Nikon TE-2000E2 inverted microscope equipped with a Solamere Technology-modified Yokogawa CSU10 spinning disk confocal scan head.
Z-stacks were acquired at 0.
Bright-field images were acquired using a Zeiss Axioskop 2 Plus equipped with an Axiocam HRC color digital camera and Axiovision 4.
Cell Fractionation and Protein Analysis Kidney cytoplasmic and nuclear extracts were prepared using the CelLytic Nuclear Extraction Kit Sigma protocol.
For Western blot analysis, proteins were separated by SDS-PAGE and electrotransferred to Immobilon P Millipore, Bedford, MA.
After transfer, blots were blocked with Tris-buffered saline with 0.
RNA isolation, cDNA synthesis, PCR primer design, and quantitative real-time PCR were performed as described previously using an ABI Prism 7500 Applied Biosystems, Foster City, CA.
PCR primers are listed in.
All quantitative PCR reactions were performed in duplicate, and melting curves verified that a single product was amplified.
Standard curves were generated by 10-fold serial нажмите чтобы увидеть больше of a pool of mutant p20 mouse kidney cDNA, and for each gene, the threshold cycle was related to log cDNA dilution by linear regression analysis.
Gene expression data were normalized to glyceraldehyde-3-phosphate dehydrogenase expression.
Statistical Analyses To normalize the variance, kidney weight and BUN data were logarithmically transformed, and mitotic index data calculated by counting the number of phosphohistone-staining cells present in at least 1000 collecting duct cells were square root transformed; then, data were analyzed by one-way ANOVA and compared using the Tukey compromise posthoc test SuperANOVA; Abacus Concepts, Berkeley, CA.
Gene expression data were by transformation to natural logarithms and analyzed by two-factor factorial ANOVA PASW version 18; IBM-SPSS Inc.
Circular mean mitotic spindle orientation, circular standard deviation, and 95% confidence intervals were calculated as previously described using the von Mises distribution followed by Kolmogorov—Smirov two-sample testing to ascertain whether there was a statistically significant difference in the distribution of mitotic spindle orientation angles in control versus experimental mice.
Computations were performed using the PMag 4.
Accession number for mouse IFT140 is.
We thank William Monis, Dr.
Brian Keady, and members of the Harvard Center for PKD research for critical comments, Drs.
Stephen Jones University of Massachusetts Medical School Transgenic Mouse Core and Paul Furcinitti University of Massachusetts Medical School Digital Imaging Core for assistance, Dr.
Paul Odgren for use of his bright-field microscope, and Bethany Walker for making the IFT140 antibody.
Studies were supported by National Institutes of Health Grant GM060992 to G.
Core resources supported by Diabetes Endocrinology Research Center Grant DK32520 were used.
Published online ahead of print.
Publication date available at.
This article contains supplemental material online at.
Pedersen LB, Rosenbaum JL: Intraflagellar transport IFT role in ciliary assembly, resorption and signalling.
Satir P, Christensen ST: Structure and function of mammalian cilia.
Pazour GJ: Intraflagellar transport and cilia-dependent renal disease: The ciliary hypothesis of polycystic kidney disease.
Gallagher AR, Germino GG, Somlo S: Molecular advances in autosomal dominant polycystic kidney disease.
Cole DG, Diener DR, Himelblau AL, Beech PL, Fuster JC, Rosenbaum JL: Chlamydomonas kinesin-II-dependent intraflagellar transport IFT : IFT particles contain proteins required for ciliary assembly in Caenorhabditis elegans sensory neurons.
Ou G, Koga M, Blacque OE, Murayama T, Ohshima Y, Schafer JC, Li C, Yoder BK, Leroux MR, Scholey JM: Sensory ciliogenesis in Caenorhabditis elegans: Assignment of IFT components into distinct modules based on transport and phenotypic profiles.
Follit JA, Xu F, Keady BT, Pazour GJ: Characterization of mouse IFT complex B.
Perkins LA, Hedgecock EM, Thomson JN, Culotti JG: Mutant sensory cilia in the nematode Caenorhabditis elegans.
Pazour GJ, Dickert BL, Vucica Y, Seeley ES, Rosenbaum JL, Witman GB, Cole DG: Chlamydomonas IFT88 and its mouse homologue, polycystic kidney disease gene tg737, are required for assembly of cilia and flagella.
Murcia NS, Richards WG, Yoder BK, Mucenski ML, Dunlap JR, Woychik RP: The Oak Ridge Polycystic Kidney orpk disease gene is required for left-right axis determination.
Huangfu D, Liu A, Rakeman AS, Murcia NS, Niswander L, Anderson KV: Hedgehog signalling in the mouse requires intraflagellar transport proteins.
Jonassen JA, San Agustin J, Follit JA, Pazour GJ: Deletion of IFT20 in the mouse kidney causes misorientation of the mitotic spindle and cystic kidney disease.
Marszalek JR, Ruiz-Lozano P, Roberts E, Chien KR, Goldstein LSB: Situs inversus and embryonic ciliary morphogenesis defects in mouse mutants lacking the KIF3A subunit of kinesin-II.
Nonaka S, Tanaka Y, Okada Y, Takeda S, Harada A, Kanai Y, Kido M, Hirokawa N: Randomization of left-right asymmetry due to loss of nodal cilia generating leftward flow of extraembryonic fluid in mice lacking KIF3B motor protein.
Lin F, Hiesberger T, Cordes K, Sinclair AM, Goldstein LS, Somlo S, Igarashi P: Kidney-specific inactivation of the KIF3A subunit of kinesin-II inhibits renal ciliogenesis and produces нажмите чтобы перейти kidney disease.
Absalon S, Blisnick T, Kohl L, Toutirais G, Doré G, Julkowska D, Tavenet A, Bastin P: Intraflagellar transport and functional analysis of genes required for flagellum formation in trypanosomes.
Qin H, Rosenbaum JL, Barr MM: An autosomal recessive polycystic kidney disease gene homolog is involved in intraflagellar transport in C.
Absalon S, Blisnick T, Bonhivers M, Kohl L, Cayet N, Toutirais G, Buisson J, Robinson D, Bastin P: Flagellum elongation is required for correct structure, https://xn--c1akdctmh4h.xn--p1ai/amp/setevoy-nakopitel-synology-rs1219-bez-hdd.html and function of the flagellar pocket in Trypanosoma brucei.
Lee E, Sivan-Loukianova E, Eberl DF, Kernan MJ: An IFT-A protein is required to delimit functionally distinct zones in mechanosensory cilia.
Blacque OE, Li C, Inglis PN, Esmail MA, Ou G, Mah AK, Baillie DL, Scholey JM, Leroux MR: The WD repeat-containing protein IFTA-1 is required for retrograde intraflagellar transport.
Iomini C, Babaev-Khaimov V, Sassaroli M, Piperno G: Protein particles in Chlamydomonas flagella undergo a transport cycle consisting of four phases.
Iomini C, Li L, Esparza JM, Dutcher SK: Retrograde intraflagellar transport mutants identify complex A proteins with multiple genetic interactions in reinhardtii.
Mukhopadhyay S, Wen X, Chih B, Nelson CD, Lane WS, Scales SJ, Jackson PK: TULP3 bridges the IFT-A complex and membrane phosphoinositides to promote trafficking of G protein-coupled receptors into primary cilia.
Tran PV, Haycraft CJ, Besschetnova TY, Turbe-Doan A, Stottmann RW, Herron BJ, Chesebro AL, Qiu H, Scherz Https://xn--c1akdctmh4h.xn--p1ai/amp/polubotinki-bi-amp-ki-1.html, Shah JV, Yoder BK, Beier DR: THM1 negatively modulates mouse sonic hedgehog signal transduction and affects retrograde intraflagellar transport in cilia.
Qin J, Lin Y, Norman RX, Ko HW, Eggenschwiler JT: Intraflagellar transport protein 122 antagonizes Sonic Hedgehog signaling and controls ciliary localization of pathway components.
Mill P, Lockhart PJ, Fitzpatrick E, Mountford HS, Hall EA, Reijns MA, Keighren M, Bahlo M, Bromhead CJ, Budd P, Aftimos S, Delatycki MB, Savarirayan R, Jackson IJ, Amor DJ: Human and mouse mutations in WDR35 cause short-rib polydactyly syndromes due to abnormal ciliogenesis.
Walczak-Sztulpa J, Eggenschwiler J, Osborn D, Brown DA, Emma F, Klingenberg C, Hennekam RC, Torre G, Garshasbi M, Tzschach A, Szczepanska M, Krawczynski M, Zachwieja J, Zwolinska D, Beales Нажмите чтобы перейти, Ropers HH, Latos-Bielenska A, Kuss AW: Cranioectodermal Dysplasia, Sensenbrenner syndrome, is a ciliopathy caused by mutations in the IFT122 gene.
Tsujikawa M, Malicki J: Intraflagellar transport genes are essential for differentiation and survival of vertebrate sensory neurons.
Gilissen C, Arts HH, Hoischen A, Spruijt L, Mans DA, Arts P, van Lier B, Steehouwer M, van Reeuwijk J, Kant SG, Roepman R, Knoers NV, Veltman JA, Brunner HG: Exome sequencing identifies WDR35 variants involved in Sensenbrenner syndrome.
Arts HH, Bongers EM, Mans DA, van Beersum SE, Oud MM, Bolat E, Spruijt L, Cornelissen EA, Schuurs-Hoeijmakers JH, de Leeuw N, Cormier-Daire V, Brunner HG, Knoers NV, Roepman R: C14ORF179 encoding IFT43 is mutated in Sensenbrenner syndrome.
Zaffanello M, Diomedi-Camassei F, Melzi ML, Torre G, Callea F, Emma F: Sensenbrenner syndrome: A new member of the hepatorenal fibrocystic family.
Austin CP, Battey JF, Bradley A, Bucan M, Capecchi M, Collins FS, Dove WF, Duyk G, Dymecki S, Eppig JT, Grieder FB, Heintz N, Hicks G, Insel TR, Joyner A, Koller BH, Lloyd KC, Magnuson T, Moore MW, A, Pollock JD, Roses AD, Sands AT, Seed B, Skarnes WC, Snoddy J, Soriano P, Stewart DJ, Stewart F, Stillman B, Varmus H, Varticovski L, Verma IM, Vogt TF, von Melchner H, Witkowski J, Woychik RP, Wurst W, Yancopoulos GD, Young SG, Zambrowicz B: The knockout mouse project.
Skarnes WC, Rosen B, West AP, Koutsourakis M, Bushell W, Iyer V, Mujica AO, Thomas M, Harrow J, Cox T, Jackson D, Severin J, Biggs P, Fu J, Nefedov M, de Jong PJ, Stewart AF, Bradley A: A conditional knockout resource for the genome-wide study of mouse gene function.
Deane JA, Cole DG, Seeley ES, Diener DR, Rosenbaum JL: Localization of intraflagellar transport protein IFT52 identifies basal body transitional fibers as the docking site for IFT particles.
Follit JA, Tuft RA, Fogarty KE, Pazour GJ: The intraflagellar transport protein IFT20 is associated with the Https://xn--c1akdctmh4h.xn--p1ai/amp/chaynik-zigmund-amp-shtain-ke-710.html complex and is required for cilia assembly.
Delaval B, Bright A, Lawson ND, Doxsey S: The cilia protein IFT88 is required for spindle orientation in mitosis.
Yu J, Carroll TJ, McMahon AP: Sonic hedgehog regulates proliferation and differentiation of mesenchymal cells in the mouse metanephric kidney.
Costantini F, Kopan R: Patterning a complex organ: Branching morphogenesis and nephron segmentation in kidney development.
Fischer E, Legue E, Doyen A, Nato F, Nicolas JF, Torres V, Yaniv M, Pontoglio M: Defective planar cell polarity in polycystic kidney disease.
Saburi S, Hester I, Fischer E, Pontoglio M, Eremina V, Gessler M, Quaggin SE, Harrison R, Mount R, McNeill H: Loss of Fat4 disrupts PCP signaling and oriented cell division and leads to cystic kidney disease.
Goilav B: Apoptosis in polycystic kidney disease.
Saadi-Kheddouci S, Berrebi D, Romagnolo B, Cluzeaud F, Peuchmaur M, Kahn A, Vandewalle A, Perret C: Early development of polycystic kidney disease in transgenic mice expressing an activated mutant of the beta-catenin gene.
Merkel CE, Karner Autodesk Architecture Engineering & Construction Collection IC Commercial New Multi-user ELD 3-Y, Carroll TJ: Molecular regulation of kidney development: is the answer blowing in the Wnt?
Reidy KJ, Rosenblum ND: Cell and molecular biology of kidney development.
Wong SY, Reiter JF: The primary cilium at the crossroads of mammalian hedgehog signaling.
Happé H, van der Wal AM, Leonhard WN, Kunnen SJ, Breuning MH, de Heer E, Peters DJ: Altered Hippo signalling in polycystic kidney disease.
Mrug M, Zhou J, Woo Y, Cui X, Szalai AJ, Novak J, Churchill GA, Guay-Woodford LM: Overexpression of innate immune response genes in a model of recessive polycystic kidney disease.
Pigino G, Geimer S, Lanzavecchia S, Paccagnini E, Cantele F, Diener DR, Rosenbaum JL, Lupetti P: Electron-tomographic analysis of intraflagellar transport particle trains in situ.
Nishio S, Tian X, Gallagher AR, Yu Z, Patel V, Igarashi Ссылка страницу, Somlo S: Loss of oriented cell division does not initiate cyst formation.
Hu B, He X, Li A, Qiu Q, Li C, Liang D, Zhao P, Ma J, Coffey RJ, Zhan Q, Wu G: Cystogenesis in ARPKD results from increased apoptosis in collecting duct epithelial cells of Pkhd1 mutant kidneys.
Ostrom L, Tang MJ, Gruss P, Dressler GR: Reduced Pax2 gene dosage increases apoptosis and slows the progression of renal cystic disease.
Soucek L, Evan GI: The ups and downs of Myc biology.
Habbig S, Bartram MP, Müller RU, Schwarz R, Andriopoulos N, Chen S, Sägmüller JG, Hoehne M, Burst V, Liebau MC, Reinhardt HC, Benzing T, Schermer B: NPHP4, a cilia-associated protein, negatively regulates the Hippo pathway.
Norman J: Fibrosis and progression of autosomal dominant polycystic kidney disease ADPKD.
Zhou Радиатор системы охлаждения DENSO, Ouyang X, Cui X, Schoeb Продолжить чтение, Smythies LE, Johnson MR, Guay-Woodford LM, Chapman AB, Mrug M: Renal CD14 expression correlates with the progression of cystic kidney disease.
Davenport JR, Watts AJ, Roper VC, Croyle MJ, van Groen T, Wyss JM, Nagy TR, Kesterson RA, Yoder BK: Disruption of intraflagellar transport in adult mice leads to obesity and slow-onset cystic kidney disease.
Patel V, Li L, Cobo-Stark P, Shao X, Somlo S, Lin F, Igarashi P: Acute kidney injury and aberrant planar cell polarity induce cyst formation in mice lacking renal cilia.
Farley FW, Soriano P, Steffen LS, Dymecki SM: Widespread recombinase expression using FLPeR flipper mice.
Pazour GJ, San Agustin JT, Follit JA, Rosenbaum JL, Witman GB: Polycystin-2 localizes to kidney cilia and the ciliary level agree, IVY & OAK Длинное платье that elevated in orpk mice with polycystic kidney disease.

Мясорубка Severin FW 3781

Комментарии 13

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *